snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA43L2
sequence
GCTGTCCTGGACCTGCCAGCTGCACAGATGCAGATGCTCTGCTATGCCTGTAACATCGG
GGCGAAGTGAAAGTGGCTATTTCTACACTCAGTGTTCAGAAAACACTGAACAACAAGAAT
GGATAATAGCCTGACATTT
  Box motif
  Complementary to target RNA
length 138
organism Homo_sapiens
snoRNA name SNORA43L2
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:161:AC034186.5
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved