snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD55L2
sequence
AGTGTATGATGACACCTTGGTAATGCTGCAGACTCCTCAGTGTGCAGTGAAGAGGTGAA
CTTTGAAGAGTCACATATGTG
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SNORD55L2
alias
chromosome ⁄ contig 10
locus ⁄ host gene Mono:10:AC024072.5
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved