snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA71CL2
sequence
GTCTGCATTTGAAAGTGATCATCAGCTAGCCTGTGTCTTCGTCATCGATAGTACAGGCC
GGTGAACTGCGCAAAGCATTTTCTGCATTTGGAGGGTCCATCTCTATCCTTGGAAATGCT
AGTGCTTTTCTCACA
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA71CL2
alias
chromosome ⁄ contig 20
locus ⁄ host gene Mono:22:AL391693.1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved