snOPY snoRNA Orthological Gene Database
Homo_sapiens AC018563.7
sequence
AAGACGATACTTTCAAGAATCATGATCATTCTATACAGTTCATTACTAGAAAAGTTTCT
CTAAACATGTAGAGCGCTGGAAGCCATGAGGAGGAGTCTCAGTGTTGTTGCCTGAGCATG
AAGCAGACTCTTGTTGCTTCACTGCAACCACCATGTACCATTGATGATGGTTCTTCTCTT
CCTCCAGGAGAGTAAGAGGGAAAGAATTCAGTCTGAGTGG
  Box motif
  Complementary to target RNA
length 219
organism Homo_sapiens
snoRNA name AC018563.7
alias
chromosome ⁄ contig 15
locus ⁄ host gene Mono:66:AC018563.7
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved