snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA63.10-201
sequence
aggcaggtactgttagaatataactgaagtgttttattgttattgtcattgcttaaagc
attggatacataactatctctaactccattccatactaagacagagatgttgcatctcaa
acat
  Box motif
  Complementary to target RNA
length 123
organism Homo_sapiens
snoRNA name SNORA63.10-201
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:104:AC093777.4
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved