snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA67L5
sequence
ATCCAAGGGGATTCCCTCTCCAAGGGAACATGCAGTGCCCCTCTCAGGAAAGTAACAAC
CTGGAATAGAATCTGGCATGCCTAAGGTCTTTGAGGAATAGAGGAATAGAGGATGCTTGT
TTCCTCTGCCTTCCTTGGCTGCCTACATGG
  Box motif
  Complementary to target RNA
length 149
organism Homo_sapiens
snoRNA name SNORA67L5
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:285:AC012119.8
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved