snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD75
sequence
AGCCTGTGATGCTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAATTCTATTCTGAGGC
T
  Box motif
  Complementary to target RNA
length 60
organism Homo_sapiens
snoRNA name SNORD75
alias U75
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C4032
accession no NR_003941,NT_004487
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved