snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD77
sequence
AGATACTATGATGGTTGCATAGTTCAGCAGATTTAATCATGAAGAGATGTACTATCTGT
CTGATGTATCT
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD77
alias U77
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1521
accession no AF141346,NT_004487
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved