snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70EL2
sequence
CTACAATCAATTAAGCCACACAGCTCTTTTTCTCATGGGGCCTGGTGTGCAAGGGCTGC
AAACAGCAGCATCCTAGGTAGTGTACAGCAGCCTGTTCCTTGTGTACAACA
  Box motif
  Complementary to target RNA
length 110
organism Homo_sapiens
snoRNA name SNORA70EL2
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:118:AC107393.4
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved