snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA32L3
sequence
TGGTTGTTACCAAGGCATTTAGCATGCAATTTCTCATTTGCTGTGGACACGACGAGAAG
AGAATTCCTCACTCGGTTTTCTGTCTGCCACCTTGCTAGCGATCAGCCCACTGGGAACAT
TT
  Box motif
  Complementary to target RNA
length 121
organism Homo_sapiens
snoRNA name SNORA32L3
alias
chromosome ⁄ contig 21
locus ⁄ host gene Mono:309:AP001610.1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved