snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD74L4
sequence
ATGTGATGCCTCTGATGAAGCCTATGTTAGTAGAGACATCTGAGAGTGTAGATGAATGC
CAATGGCCCTCATGGAAAGAG
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SNORD74L4
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:251:AC126172.8
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved