snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA67L1
sequence
AGGTCTGATATCCAACATCTATAAGGAACTTAAACAAATTTACAAGGGAAAAGCAACCC
CATTAAAAAGTGGGCAAAGTAAGGTCTTTGGGGAACAGGGATGCTTATTTCCTCTGCCTT
CCTTGTCTGCCTACACGG
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA67L1
alias
chromosome ⁄ contig 9
locus ⁄ host gene Mono:141:AL160271.19
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved