snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70CL2
sequence
CTGCAGCCAGTTAAGCCACCTGAGTTCCTTTCCTCATAGGGGTCCAATGTGCAATGGCT
GCAAACAGCCGCTTCCCTGTAGTATATGCTGCCCATTTCTTGTATGGGTTGCTCTAAGGG
ACCTTGGAGACAGGC
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA70CL2
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:282:AC019176.4
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved