snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD115-48L1
sequence
AGGCCAATGCTGAATTATTATCTTGACGAGAAATGATGACGTAAAAATTAAGCTTAGTA
GGATTACACTGAGGCCC
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD115-48L1
alias
chromosome ⁄ contig 10
locus ⁄ host gene Mono:7:AL160060.11
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved