snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@L32
sequence
AAGCCTATGCATTCTGGGATCATTTCGATAGCTCGTTCCTGGAGAAGTTTCTCTGAGCA
CCAGAAGCCACAAGGAGCAGGCCCAGCATTCCCTCCCGAGCAGGCCCAGCGTTCCCTCCC
GAGCAGGAGCCGTCGTCTGTGTTGCTTCCCTGCAAGTACCATTCGCCACTGATGACCATT
CTTCTGTTCCTCTGGGAGAGTAAGAGGGAGAGGATGTAGTCTGAGAGG
  Box motif
  Complementary to target RNA
length 227
organism Homo_sapiens
snoRNA name SNORD3@L32
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:56:AC124861.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved