snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD78L1
sequence
CTGTAATGATGTTGCTCAAATATCTGACCTGAAATGATTATATAGACCAATTTAATACT
GAAGAA
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD78L1
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:34:AC073875.6
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved