snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD38BL3
sequence
TCTTAGTGATGAAAACTTTGTCCAGTTCTGCTAATGACTTTAAGTGATGATAAACTATG
TCTGAGGGGA
  Box motif
  Complementary to target RNA
length 69
organism Homo_sapiens
snoRNA name SNORD38BL3
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:287:AC108863.4
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved