snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD25
sequence
TTCCTATGATGAGGACCTTTTCACAGACCTGTACTGAGCTCCGTGAGGATAAATAACTC
TGAGGAGA
  Box motif
  Complementary to target RNA
length 67
organism Homo_sapiens
snoRNA name SNORD25
alias U25
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G1490
accession no NR_002565,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved