snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD28
sequence
GTCAGATGATTTGAATTGATAAGCTGATGTTCTGTGAGGTACAAAAGTTAATAGCATGT
TAGAGTTCTGATGGCA
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD28
alias U28
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C1391
accession no NR_002562,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved