snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD29
sequence
TTTCTATGATGAATCAAACTAGCTCACTATGACCGACAGTGAAAATACATGAACACCTG
AGAAAC
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD29
alias U29
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A4493
accession no NR_002559,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved