snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD22
sequence
TCCCAATGAAGAAACTTTCACATGTCTTACTCTCTGTCCTAGTCCCAGAGCCTGTAAAG
GTGAACCCACTGGGACTGGCTGGGGGAGAAGAGGAAGATTTGTTCCAGAAGGAACTGTCT
GAGGGAT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORD22
alias U22
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site Processing
accession no NR_000008,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved