snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD6L1
sequence
AAATGTTATGATATGAGCAAAATGTTCAACTATTCCAAATGGGCTGAGTGAAAATAGGT
TTTCTGAGCATCC
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD6L1
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:169:AC107024.5
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved