snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118L7
sequence
TGGTCAGGTGGAATAATCCTTATCTGTTTCTCCTTTTGAAGGGCAGATTAGAACATGAT
AATTGGAGTTCACATGATACATGATTAAAGTCTCTGTGTAATCATGACTTACAATATCCT
GATTATTCCTATCTTAT
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORD118L7
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:180:AC125618.1
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved