snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD59BL2
sequence
CCTCATTGATTAGTAGCTTCTGACTTTTGTTCTGAGTTTGCTGAAGCTAGATGCCATTC
CAGATAAGA
  Box motif
  Complementary to target RNA
length 68
organism Homo_sapiens
snoRNA name SNORD59BL2
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:51:AC006196.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved