snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA20L4
sequence
CTTCCCATTTATTTGCTGGTATAATGATACAATGATATGAGCAGTTATACTCTTTGGAA
AAAATAATATTGGGCCATTGTAAATTGACATGAAGTAAGTATTTTCATATCATCTGCAAT
GGACTAGATGTTG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA20L4
alias
chromosome ⁄ contig Y
locus ⁄ host gene Mono:77:AC011749.2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved