snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD37L1
sequence
GTAGGTGACGACCAATATTTTTTTTACTTTGACTTGATGTCTATTGAAGAAATCTAGCA
TCTGAGA
  Box motif
  Complementary to target RNA
length 66
organism Homo_sapiens
snoRNA name SNORD37L1
alias
chromosome ⁄ contig 13
locus ⁄ host gene Mono:154:AL139003.9
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved