snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70BL4
sequence
CTGCAACCAATTAAGCTGACTGAATTCCTTTCCTCCCGGGGGCCAGGTGTGCAATGGCT
GCAAACAGCAGCTTCCTTGGTAGTGTACGCAGCCTGTTTCTTGTATGCGTTGCTCTAAGG
GACCTTGGAGACAGGC
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA70BL4
alias
chromosome ⁄ contig 21
locus ⁄ host gene Mono:307:AP000281.1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved