snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA76
sequence
GCGCTGCCTTTGTACCCCACCGTGCCTCCGCCTGGTGTCTGGGGTCAGGTTGCAGTGCC
AGAGCACGTGCTTGCGCATAAATGGGGCAGCCTGGCCCCCTGCGGATGGTCCTTTTAACC
GCGAGCAACAAGG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA76
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:127:AC010273.8
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved