snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD45BL1
sequence
GGTCAATGATGTCGTGGCATGTATCAGCTGAATCCAAAGTTGATGTGAGTTCCAAAATT
ATACTGAGACTTT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD45BL1
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:102:AL627443.6
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved