snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118L12
sequence
TAGTCAGGCGGGATAATCCTTACCTGTGCCTCCTTTTGGAGGGCAGCAGAATGTGGTAG
TTGGAATTGCATGATACTTGATTCATATCTCTGTGTAATGATGGCATGCAATACCCTGAC
TGCTCCTTTCGAAT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORD118L12
alias
chromosome ⁄ contig 15
locus ⁄ host gene Mono:60:AC120045.19
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved