snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA22
sequence
TTGCACAGTGAACACCCAAGTGTGCTTTATAGTTCCCTTGGCTTTGACCCTGTGCTAGA
GCATTGCCTGCTCTTCTCCTCTGCATTGAAAGGAATATTTATCCCTTTAAATGTATTCAG
AAAGCCAGCACATTA
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA22
alias
chromosome ⁄ contig 7
locus ⁄ host gene LOC649553
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4966,28S:U4975
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved