snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD116-1
sequence
TGGATCGATGATGAGTCCCCTATAAAAACATTCCTTGGAAAAGCTGAACAAAATGAGTG
AGAACTCATAACGTCATTCTCATCGGAACTGAGGTCCA
  Box motif
  Complementary to target RNA
length 97
organism Homo_sapiens
snoRNA name SNORD116-1
alias HBII-85-1
chromosome ⁄ contig 15
locus ⁄ host gene hmm16326423
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no NR_003316,NT_026446
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved