snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70EL6
sequence
CTACAACCAGCTACTGGTTGATCTTACATTTGATCTGGTGTGCAATGGCTGCAAACAGC
AGCCTCCTTGGTGGTGTTTGCAGCCTGTTGCTTGTATGAGTTGCCCTAATGGACCTTGGA
GACAGCC
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA70EL6
alias
chromosome ⁄ contig 17
locus ⁄ host gene Mono:265:AC023389.13
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved