snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@L40
sequence
AAGGCTATACTTTCAGGAATCATTTCTATAGTTTGTTACAAGAGAAGTTTCTCTGAATG
TGTAGAGCACCAGAAACCACGACGAGGACGAGAAGGCACAGCATTCTTTCCTAAATGTGA
AGCCAGCTCTTGGTGTTGCTTCAACTGCCACTTGCCATTAATGACAGTTCTTCTTTCCCA
CTGGGAGAATAAAAAGGAGAGAATGCAGTCCTTT
  Box motif
  Complementary to target RNA
length 213
organism Homo_sapiens
snoRNA name SNORD3@L40
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:94:AL590814.5
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved