snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA63L9
sequence
ATGCAGGTACTGTTACAATATGACTGAAGTGATTTGTTGTCATTTCCCCTGCTTAAAGC
CCTTGATATATAACTATCTCTGTCTAACTCATTCTGAAGTAAGACAGAGATGCTTGGTTT
CATTTTT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA63L9
alias
chromosome ⁄ contig 15
locus ⁄ host gene Mono:73:AC090260.13
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved