snOPY snoRNA Orthological Gene Database
Homo_sapiens snosnR66
sequence
ATTCTTAAATGAATGATGAAATACCAAAAAGAAAAATAAGCAAAGAACAGATAACAGAA
AGAAGCACAGCAAATACAACATAATACTGACAGTAAAAAT
  Box motif
  Complementary to target RNA
length 99
organism Homo_sapiens
snoRNA name snosnR66
alias
chromosome ⁄ contig 11
locus ⁄ host gene Mono:317:AP003063.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved