snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA24
sequence
CTCCATGTATCTTTGGGACCTGTCAGCCGTGGCAGTCTCCCTTCCTAGCCATGGAAGAG
CATATCCTTGTTTATTGGCAAAGCTGTCACCATTTAATTGGTATCAGATTCTGACTTGCA
CAAGTAACATTC
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA24
alias ACA24
chromosome ⁄ contig 4
locus ⁄ host gene SNHG8
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U863,18S:U609
accession no AJ609460 NT_016354
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved