snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD74L5
sequence
GTTTCTGATGAAGCCTATGTTGGTAGGGACAACTAAGGTTGTTGATGAATGCTAACAGC
TCTAACACACACAC
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD74L5
alias
chromosome ⁄ contig 21
locus ⁄ host gene Mono:305:AP001172.1
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved