snOPY snoRNA Orthological Gene Database
Homo_sapiens AC096917.3
sequence
AAGATTATATTTCCAGGGGTCATTTCTGTGGTTCATTACTTAAAGGAGTTTCCCCAAGT
GTGTAGAGCACTGGAAACCACAGGAAGATATGCAATGTTCTCTCCCGAGCACGAAGCTCG
TTCTTGGTGTTGCTTCATTGCAACTGCCATTTGCCATTGATCATTGTTTTTTTCTTCCTT
TGGGGAGATTAAGAGGAAGAGGACACAGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 216
organism Homo_sapiens
snoRNA name AC096917.3
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:167:AC096917.3
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved