snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA76
sequence
GCGCTGTCTTTGAGCCCCCGCCGAGCTTCCTCGTGGCGCCGGGGGTCAATCTGCAGCGC
TAGAGCATGTGCTTGCGCATAACTGGGGCCGCCTGGCCTCCCGCGGGCGGCCTTTTTAAC
CGCGAGCGACAAGA
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA76
alias ACA62
chromosome ⁄ contig 17
locus ⁄ host gene Poly:10:AC025362.12
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U34,18S:U105
accession no NR_002995, NT_010783
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved