snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA33L2
sequence
AAGCTAGCCAATGAATCTGCTTACCTAAACATGTTTCTGCAGAAATTTTTATTTTAAAA
AGCTGGTAATAGTAAAGCCATTTATGAGCCTTAAGTATATTGAAGTTGTTAAGATCCCTG
AAAATGGCTATAACA
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA33L2
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:97:AL591387.4
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved