snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA2BL1
sequence
TTGGTCCTGATTCAAGGCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGACTAA
ATAATTGTCTTTTCATGGTCTGTTGGCCATCTTATAACTTTGGAAATGTAATGTCCAATT
CATTAGAAATAAACATCT
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA2BL1
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:216:AL359273.11
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved