snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70G
sequence
CTGCAGCCTATTAAGCCAACTGAGTTCCTTTCCTCATGGGGGGGCCCAGTGTGCAATGG
CTGCAAACAGCAGCTTCCTTGGTAGTGTATGCAGCCTGTGTGTTGTATTGTATGGGTTGC
TCTAAGGGACCCTGGAGACAGTC
  Box motif
  Complementary to target RNA
length 142
organism Homo_sapiens
snoRNA name SNORA70G
alias U70G
chromosome ⁄ contig 12
locus ⁄ host gene RAB1B complimentary
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1692
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved