snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD37L2
sequence
GTTCATGATAAGTAACATTTCTTCAATTTGACCTGATGTGTATTGAAGAAAACCAGCAT
CTGAGG
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD37L2
alias
chromosome ⁄ contig 14
locus ⁄ host gene Mono:273:AL359396.5
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved