snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA26
sequence
GTGCCCTTTTAAGGTTGACCCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAAGT
CTCCATAAAACCCAGAGAAGAGACTGGAAAGCTCCTCTTTGGATCCTGTCTGGAGTCACA
ACT
  Box motif
  Complementary to target RNA
length 122
organism Homo_sapiens
snoRNA name SNORA26
alias HBI-6
chromosome ⁄ contig 4
locus ⁄ host gene KIAA0114
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4522
accession no NR_003016 NT_022853
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved