snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD66L2
sequence
GTCCTCTGATGACTTCATGTTAGTGCCACCTGTCTGGGCCACGGAGAACCCATGATGGA
ACTGAGAATCTGAGGAA
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD66L2
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:89:AL365219.17
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved