snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA48L4
sequence
TTTCCCTGACCTGGGTAGAGTGGCATCCAGTTGGTGGTGCCCATCTCATATCAGCCAGG
GACAAAGCAACCCCTTGTTCCTCCCAGCTTGGCTTTTCATCTGTGCCTATGCCTGGTTCA
TGCCTTGGACACATTT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA48L4
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:198:AC141001.6
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved