snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA40L9
sequence
TGTATACTACACTGTTTTTGTTTAACTTGTGGACAAAGACTTATGGTTAGGTGCAAAAA
ATAAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGA
AGGTGTTGC
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA40L9
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:85:AL033519.42
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved