snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118L4
sequence
AGTGCTGGGATAACCCTTACCTGTTTCTCCTTTGCAGGGCAGATAGAACATGATAATTG
GAGATGCATGAAACGTGATTAATCTCTCTGTATAATCAGGACTTGCAACACACTTAATTT
TTTTTTTAATAG
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORD118L4
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:126:AC093523.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved