snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD114-24
sequence
TGGATCGATGGTGACTGTTGATGGCATATGACTCACATATGATGAGTACGTATCTGGAA
CTCTGAGGTCTGT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD114-24
alias 14q(II-24)
chromosome ⁄ contig 14
locus ⁄ host gene SNORD113@,SNORD114@
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved